Human Variation and Race

1.       High levels of solar radiation negatively impact the survival of humans by disturbing homeostasis. This can occur with either too much exposure to the sun or too little. Our body needs Vitamin D from the sun in order to function properly. Without Vitamin D our body can experience weakness in our immunity, bones, teeth, and muscles. Solar radiation provides our body with the Vitamin D that we need to strengthen our body in all those areas. It helps restore bone tissue and replaces the old bone with new bone. Also too much solar radiation can have a negative impact because the overexposure of UV rays can be absorbed into the cells and turn into skin cancer. It seems were doomed with it or without it. Solar radiation needs to be absorbed in moderation to receive the full benefits; overexposure can lead to a disruption in homeostasis and can turn into a very dangerous thing if not monitored.

   2.       Cultural Adaption: One form of a cultural adaption that humans have used to adapt to this stress is by using sunscreen. Just because you wear sunscreen when out in the sun doesn’t mean your completely safe from its harm. It does help reduce the amount of UV rays that get absorbed into your skin, but there are some that can still seep through so it is best to use other forms of adaptions such as putting an umbrella up at the beach or putting on a t-shirt if directly exposed to the sun.

 

Facultative Adaption: Since UV rays are the strongest in the summer vs. the winter most people like to lay out and tan by the pool. Even during the winter individuals will go to the tanning salons and use that as a source to maintain their summer body glow. This is an example of Facultative Adaption. Melanin increases in size and number when exposed to ultra violet radiation. This is an example of altering a phenotypic expression in response to an environmental stress. Now some people aren’t as lucky, like me most fair skinned people have a hard time tanning so not only are we altering our phenotypic expressions it can be more painful and harmful than for most. We are more likely to burn and peel and be at risk for skin cancer.

 

 
 

 

Developmental Adaption: Individuals who are exposed to the sun for longer periods of time are at a higher risk of developing skin cancer ( melanoma).  The UV rays lead to an increased production of melanin. These individuals over time will develop a darker skin tone and are more likely to develop skin cancer. Not only does over exposer of solar radiation cause developmental adaption but so does being underexposed to UV Rays. People who live in northern latitudes where there is less solar radiation are better off at protecting their skin, but for those with darker skin this becomes a serious risk. Reduced solar radiation leads to a lack of Vitamin D which can lead to life threatening conditions such as rickets disease or osteoporosis. This can have a lasting effect, for instance women who had low levels of Vitamin D for long amounts of time are at risk of having a normal delivery due to the deformities of the pelvic. It is interesting because research shows that is common for dark skinned people to be Vitamin D deficient because of lacking melanin to protect their skin, but even for myself, as white as you can get am severely Vitamin D deficient, I take 2,000 mg. I notice without it my bones hurt and crack a lot and I constantly feel tired. It just goes to show how important it really is!

 

Short Term: I don’t know If we have a short term adaption to solar radiation. With too much sun we can either increase our risk of cancer because of burning and overexposure to UV Rays, or with under exposure we lack Vitamin D which provides our body with what it needs and without it can lead to permanent life altering conditions such as heart disease or bone diseases.

   3.       I think it is important to study the benefits of human variation from this perspective because information from these explorations can help us in finding new ways to defend ourselves against the negative impacts of solar radiation or help us benefit from getting more of the sun. It is helpful to study environments where people don’t receive as much sun because we can study the effects the lack of Vitamin D and Melanin can have on them, such as bone diseases or affecting the way they have children. We are able to understand better how we can help those who need more Vitamin D.  It is also beneficial to study those environments where the sun is extremely powerful so we can see how the intake of too much Vitamin D can lead to life threatening conditions such as cancer. Looking at these different environments allows us to learn to intake the sun in a healthy way.

4.       By using race to better understand the variation of adaptions of solar radiation, we are able to discover how specific environments are better suited for the exposure of the sun, and which environments are not. I think the study of environmental influences on adaptions is a better way to understand human variation than by the use of race because we have a better understanding of how people adapted to their own environments. For example I think sometimes people might have the misconception that races with darker skin probably get the most Vitamin D because they get a lot of sun, when in at times where their environment is lacking solar radiation they develop a  higher risk of being deficient not because of their skin color but because of their environment. I know for me this was an eye opener in becoming more understanding of how our environment affects us in a great way.

 

Blog Post: Language Experiment

Part 1: I picked my dad as my partner in conversation. We chose to discuss the topic of Donald Trump running for president. I found the assignment easy, but difficult to communicate effectively. I found that my partner did alter the way he communicated with me due to the fact that my responses were limited to only non- vocalized responses. For example, when he would ask me yes or no questions it was easy for me to answer with a nod, facial expression, or some sort of body language gesture. A look of excitement or a nod typically suggested a yes, and a shrug or grossed out face signaled a no. When he got into questions such as: what is your opinion of him as the possibility of being out president? it was hard for me to answer without words and found that our conversation had hit a dead end.

I found that my partner was in control of the conversation. Since he was the one able to speak with his words, he was able to initiate or direct the topic of conversation. My partner was the one able to ask the questions, and I was the one who mainly answered. The only way I was able to direct the conversation was if he asked me a question like: do you like Donald Trump? I won’t mention my answer, but in order to ask him the same question without words, I was able to put my arm out as though I was asking him the same question in return, and he understood and was able to answer. I only did the experiment with one person, so in this case I did not feel excluded. If I think of this conversation as an exchange of power, I would say my partner held the most power. The reason he had the most power was because he was able to lead the conversation where it needed to go. He was able to redirect questions from an open ended question to a closed ended question, which without vocalization it was easier to communicate with closed ended question.

When it comes to two different cultures, one with spoken language and one with without, the one with spoken language is able to better communicate within their population. They are able to do so better because they can explain in greater detail than the one without. Not only can they explain in detail but they can do so more efficiently because they are able to get their point across more quickly. The culture without the spoken language would have a harder time getting specific details across, because they would have to take the time to either get the point across with just body language, which can be confusing or they would have to draw out signs and symbols to get their point across, which also could be taken out of context more easily than if it was spoken. Take for example texting a friend. We live in a modern day culture that is consumed by the digital world. People spend more time communicating non verbally than they do verbally. Either we are emailing, texting, or communicating through various social media outlets. Talking face to face or on the phone is become a thing of the past.  Verbal communication is straight to the point and harder to take out of context than non-verbal communication. If I send my friend a message that has an exclamation point in it (!) it can either mean, I’m excited or I’m upset. If I am able to talk to my friend over the phone she can tell immediately if I am happy or unhappy about what were are talking about.

Part 2: First of all, I found it hard not to laugh during this part of the assignment. I am so used to communicating verbally and non-verbally at the same time. I like to make faces when I talk, squint my eyes, exaggerate with my hands, etc.…. It also didn’t help my partner was staring at me like a Robert! It was a lot more difficult for me to communicate with only my words. I think eliminating your tone of voice a lone can drastically change the vibe of the conversation. My partner felt like he could not tell if I was being sincere with my answers or not. When he would ask my opinion on how would I feel if Trump became president, he thought my answers seemed vague and monotone due to the lack of non-verbal communication.

I think our non-verbal techniques are extremely important with how we communicate, and seems crazy to think of communicating without either form of language. There is a saying that states, “the majority of the time it is not what you say, it is how you say it.” If I get in an argument with my friend and I apologize, my friend won’t think I am sincerely apologizing if all I say is, “I’m sorry.” My tone of voice would have to line up with being sympathetic, i.e.… a softer, quieter tone to ensure I am genuinely sorry. Not only that but maybe I reach out my hand to grab their hand so they know I am engaged in the apology and not trying to get it over with. I think people are more likely to understand emotions such as, happiness, anger, sadness, hurt, resentment, sincerity better when the spoken language is accompanied by the non-verbal language. If my arms are crossed I am more likely to come across shy, reserved, or even anger. If I’m smiling and moving my hands around while I talk, I am more likely to come across confident, or even happy.

The adaptive benefit for someone that is able to understand body language in order to survive can be recognized in many different ways. Take for example someone who is choking they will probably be gasping for air since they can’t talk, grabbing their next and so forth. That gesture is crucial in saving their life because those that are around them are able to see them in trouble and get them the help they need in order to live. I would imagine it would be hard to sexually reproduce if body language wasn’t involved. Just a simple look or grab of the hand can let someone know they are interested in you.

People who are blind are an example of not needing nonverbal communication to understand things as well. They are not able to see hand motions or shrugs of the shoulder or a wink even. They mainly have to go off verbal communication and tone of voice to understand what is being communicated to them.

The Piltdown Hoax

The Piltdown Hoax was about the discovery of the Piltdown man who was thought to be the remaining fossilized fragments of an early unknown human. The skull seemed to be evidence of the common ancestor between ape and human. The skull had human like skull fragments with teeth that appeared to be human. This would have been significant to the scientific community because this discovery would of satisfied Charles Darwin’s theory of evolution. This would have showed the early steps of apelike ancestors to humans. The remains were found in 1912 in the town of Piltdown, East Sussex England by Charles Dawson, and later worked on by both Dawson and Arthur Woodward. What this did for the scientific community was helped prove the theory that human’s large brains evolved before they could walk upright. Doubts of the Piltdown Man started to evolve in the late 1920’s and 30’s as the discovery of other earlier human remains were found. These remains were different than that of the Piltdown man in that none of the findings were consistent with the large brain and ape like jaw of the Piltdown Man. It wasn’t until the new dating methods of fluorine testing that revealed that the skull must have been no more than 50,000- 500,000 years old. After carbon dating came about the skull was revealed to be no more than 600 years old. Too much disappointment, the skull was discovered to be a modern human skull with an orangutan jaw with filed down teeth and the hoax became official by 1953. The hoax made people lose faith in the scientific community. Scientist hit a dead end and were discouraged because they had invested so much time and effort into something that was fraud.

I think that some of the faults that came into play in this incident is that people had so much faith in Dawson because he seemed to be a well-established and trusted member of the scientific community. When people have so much faith in someone they tend to believe them more without questioning. I think that Dawson was at fault in a way because he jumped to conclusions, and the other scientist and community were at fault because they jumped on the band wagon without questioning it. They believed with blind faith. These faults negatively impacted the scientific community because by them they took a step back about 40 years. They wasted years of effort into something that wasn’t even real.

Thanks to new technology, by 1939 fluorine testing helped reveal that the remains were actually a lot younger than what they claimed to be. Fluorine testing showed the amount of fluorine, nitrogen, and uranium in bones.  This new technology proved the remains to be no more than 50,000-500,000 years old, which wouldn’t have been old enough to be our ancestors. After that came carbon dating which was the process of measuring carbon dioxide from the air for photosynthesis, this process can only be done on objects that were once living. This method proved the Piltdown Man to be no more than 600 years old.

I don’t think it is possible to remove the human factor from science nor would I want to. To me the human factor means trying your hardest and putting in all your effort and sometimes still getting the wrong result. How I look at it is it takes a hundred no’s to get one yes. Take for instance Thomas Edison, he was fired from his jobs for being called nonproductive. It took him 1,000 attempts to get the invention of the light bulb. Without human error it would be impossible to reach our greatest triumphs and in the case of science, it is all trial and error. I think human error keeps us on our toes and because of it scientist can’t be lazy, and they have to put in more time and effort into supporting their theories and testing them. I think that these technological discoveries can help us move forward with fewer errors, but at some point down the road there might be a point where we need a new discovery to help us prevent these human like errors.

A life lesson I can learn from this is that just because everyone hops on the band wagon, doesn’t mean it is the correct wagon to be on. In this case people trusted Dawson and supported his findings with little evidence. In life it is important to do my own research to make sure I know what I am supporting, and not take it at face value. I need to be diligent in discovering what I think is true and find facts that support it.

Blog Post #3

Homologous: The two species that share a homologous trait are a human and a dolphin. The arm of a human and the fin of a dolphin both share the same homologous structure. Homologous is the same structure, different function. In this case both the human arm and the fin of a dolphin share the same structure, but different function. The structure of the fin of a dolphin is composed of the same structure of a human hand. Both share a humerus, ulna, phalanges, and ball and socket joints. Although their structure is alike their function is different. The function of the human arm is to be able to do things such as, picking stuff up, writing, lifting, and many other things. The function of the dolphin flipper is to help keep balance and help the dolphin to stop and turn. Both Species share a common ancestor, however over the years of evolution this similar trait has evolved into different functions. Given that both species have a humerus, I would say the common ancestor is a mammal.

Analogous: Two different species that share analogous traits are the flying squirrel and the sugar glider. Both species contain a couple similarities, like the big eyes and contain a piece of skin stretched between their arms and legs to help them glide through the air. There are also some key differences in these creatures. First the flying squirrel is a placental mammal, meaning the baby spends all the time developing in the womb being fed by the placenta. Sugar gliders are marsupial animals, which means they only spend a little bit of time developing in the mother’s womb and continues to develop outside the mom’s womb. These species share similarities due to the fact that they both adapted from lineages with the same lifestyle function. Including gliding from tree to tree and being able to see at night. They are different because they live in two different parts of the world. The differences in territories creates some differences in their behaviors. One being that sugar gliders have scent glands to distinguish their territories as flying squirrels do not have this function. Also sugar gliders very rarely set foot on ground, and flying squirrels will. My research concludes that the adaption of similar traits occurred separately and was not passed down by a shared ancestor.  I was unable to find a definite answer if their ancestors shared the same analogous trait.

Week 2/ Protein Synthesis

 *DNA STRAND:

  TTGATACCAAGTAAGTGTTAGCCGTTGGAAATCTATCCCGA

Historical Influences on Darwin

1.     

           1.  I think that Jean- Baptiste Lamark had great influence over Charles Darwin’s theory of natural selection. Thanks to Lamark’s idea that the environment altered the individuals and through that changes were inherited. This only help solidify and validate Darwin’s theory that the variation of species already existed and that nature decided who and what was best suitable to carry on. This led him to the theory of “the survival of the fittest.”

2.       2. One major contribution Lamark made to evolution is Biology. He realized the importance in the way organisms and the external environment interacted with one another. Biology lead him to study the way species change. He believed that when the environment went through changes that organisms also had to change with it to survive. All of this led him to be best known for the theory of inheriting acquired characteristics. (http://evolution.berkeley.edu/evolibrary/article/history_09)

3.    3.    The bullet point that stating if the environment changes, the traits that are helpful or adaptive to that environment will be different is most directly affect by Lamark’s work. For example; he believed that after Giraffes had finished eating from the bottom of the tree that they would have to stretch their necks to get to the leaves on the top. Over time their necks would become gradually longer to be able to keep up with their needs. He believed as the environment changed that an animal’s activity patterns had to change as well to keep up with their circumstances. This theory was later proven to be incorrect only helping move Darwins theory that nature selected the most fit to survive.

4.     4.   I think ultimately he could have proven his theory of natural selection without the help of Lamark. However, having other theories be falsified around him only helped in supporting his theory further. I think that it didn’t hurt to have another theory differ from his own, rather helped challenge his own theory that the environment decided which traits were best fit to survive and which were to die off.

5.     5.   There was such a fear that evolution would eventually cause the church to crash by leading people away from the original beliefs that revolved around God being the creator of everything. However Darwin was indifferent to religion and it wasn’t until he felt that Wallace would get credit for the theory or natural process that he went forward and decided to publish the Origin of Species.

If I was stranded on an island and could only bring two things, it definitely would not be a volleyball named Wilson :) First I would bring sunscreen, so I wouldn't fry like a lobster. I am very pale and my skin was not meant to be stranded on an island unprotected. Second item I would bring would be my boyfriend. I would bring him along so I wouldn't get lonely or crazy..... At least with the two of us stranded together our odds of getting off the island would be a lot better!