Blog Post #3

Homologous: The two species that share a homologous trait are a human and a dolphin. The arm of a human and the fin of a dolphin both share the same homologous structure. Homologous is the same structure, different function. In this case both the human arm and the fin of a dolphin share the same structure, but different function. The structure of the fin of a dolphin is composed of the same structure of a human hand. Both share a humerus, ulna, phalanges, and ball and socket joints. Although their structure is alike their function is different. The function of the human arm is to be able to do things such as, picking stuff up, writing, lifting, and many other things. The function of the dolphin flipper is to help keep balance and help the dolphin to stop and turn. Both Species share a common ancestor, however over the years of evolution this similar trait has evolved into different functions. Given that both species have a humerus, I would say the common ancestor is a mammal.

Analogous: Two different species that share analogous traits are the flying squirrel and the sugar glider. Both species contain a couple similarities, like the big eyes and contain a piece of skin stretched between their arms and legs to help them glide through the air. There are also some key differences in these creatures. First the flying squirrel is a placental mammal, meaning the baby spends all the time developing in the womb being fed by the placenta. Sugar gliders are marsupial animals, which means they only spend a little bit of time developing in the mother’s womb and continues to develop outside the mom’s womb. These species share similarities due to the fact that they both adapted from lineages with the same lifestyle function. Including gliding from tree to tree and being able to see at night. They are different because they live in two different parts of the world. The differences in territories creates some differences in their behaviors. One being that sugar gliders have scent glands to distinguish their territories as flying squirrels do not have this function. Also sugar gliders very rarely set foot on ground, and flying squirrels will. My research concludes that the adaption of similar traits occurred separately and was not passed down by a shared ancestor.  I was unable to find a definite answer if their ancestors shared the same analogous trait.

Week 2/ Protein Synthesis

 *DNA STRAND:

  TTGATACCAAGTAAGTGTTAGCCGTTGGAAATCTATCCCGA

Historical Influences on Darwin

1.     

           1.  I think that Jean- Baptiste Lamark had great influence over Charles Darwin’s theory of natural selection. Thanks to Lamark’s idea that the environment altered the individuals and through that changes were inherited. This only help solidify and validate Darwin’s theory that the variation of species already existed and that nature decided who and what was best suitable to carry on. This led him to the theory of “the survival of the fittest.”

2.       2. One major contribution Lamark made to evolution is Biology. He realized the importance in the way organisms and the external environment interacted with one another. Biology lead him to study the way species change. He believed that when the environment went through changes that organisms also had to change with it to survive. All of this led him to be best known for the theory of inheriting acquired characteristics. (http://evolution.berkeley.edu/evolibrary/article/history_09)

3.    3.    The bullet point that stating if the environment changes, the traits that are helpful or adaptive to that environment will be different is most directly affect by Lamark’s work. For example; he believed that after Giraffes had finished eating from the bottom of the tree that they would have to stretch their necks to get to the leaves on the top. Over time their necks would become gradually longer to be able to keep up with their needs. He believed as the environment changed that an animal’s activity patterns had to change as well to keep up with their circumstances. This theory was later proven to be incorrect only helping move Darwins theory that nature selected the most fit to survive.

4.     4.   I think ultimately he could have proven his theory of natural selection without the help of Lamark. However, having other theories be falsified around him only helped in supporting his theory further. I think that it didn’t hurt to have another theory differ from his own, rather helped challenge his own theory that the environment decided which traits were best fit to survive and which were to die off.

5.     5.   There was such a fear that evolution would eventually cause the church to crash by leading people away from the original beliefs that revolved around God being the creator of everything. However Darwin was indifferent to religion and it wasn’t until he felt that Wallace would get credit for the theory or natural process that he went forward and decided to publish the Origin of Species.

If I was stranded on an island and could only bring two things, it definitely would not be a volleyball named Wilson :) First I would bring sunscreen, so I wouldn't fry like a lobster. I am very pale and my skin was not meant to be stranded on an island unprotected. Second item I would bring would be my boyfriend. I would bring him along so I wouldn't get lonely or crazy..... At least with the two of us stranded together our odds of getting off the island would be a lot better!